Sequence ID | >WENV171002443 |
Genome ID | NHNJ01043551 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 1242 |
End posion on genome | 1153 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttcatataac |
tRNA gene sequence |
GGAGAGATGGCAGAGCGGTTGAACGCATCAGTCTTGAAAACTGACAAGGGTGCAAGCCCT |
Downstream region at tRNA end position |
cgcttactaa |
Secondary structure (Cloverleaf model) | >WENV171002443 Ser TGA c GCCA cgcttactaa G - C G - C A - T G - C A - T G - C A - T T A T G A C C C A C G A G | | | | | G G G A C G C T G G G C G | | T T T A C G C T G A A CAAGGGTGCAAGCCCTTC T - A C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |