Sequence ID | >WENV171002542 |
Genome ID | NHNJ01083023 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 522 |
End posion on genome | 612 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttccgctgcT |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC |
Downstream region at tRNA end position |
taaacaagtc |
Secondary structure (Cloverleaf model) | >WENV171002542 Ser GCT T GTtt taaacaagtc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G | | | T T T A A G C T G A G TACAGGAGGCAACTTCTGTC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |