Sequence ID | >WENV171002612 |
Genome ID | NHNJ01100439 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 250 |
End posion on genome | 336 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ataacaaata |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCAACGCGTAAGTGTTGCC |
Downstream region at tRNA end position |
gtaaagaatt |
Secondary structure (Cloverleaf model) | >WENV171002612 Ser GCT a GCAA gtaaagaatt G - C G - C A - T G - C A - T G - C G + T T A T G G C C C A G A G | | | | | G T G A C C C C G G G C G | | | T T G A T G G T A A CAACGCGTAAGTGTTGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |