| Sequence ID | >WENV171003145 |
| Genome ID | NNBT01001888 |
| Phylum/Class | [NNBT] plant metagenome; symbiotic tissue sample KVJ10 |
| Species | |
| Start position on genome | 452 |
| End posion on genome | 524 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ggagtaccaa |
| tRNA gene sequence |
CGGGATGTAATTCAGCGGCCAGAAGCCATGCTTTGGGAGCATGGAGTCGCAGGTTCAAAT |
| Downstream region at tRNA end position |
gcccctgtga |
| Secondary structure (Cloverleaf model) | >WENV171003145 Pro TGG
a Atat gcccctgtga
C - G
G - C
G - C
G - C
A - T
T - A
G - C T A
T C G T C C A
C G A A | | | | | A
G C T T A G C A G G C
G | | | T T
C G A A G
C A C GAGTC
C - G
A - T
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |