Sequence ID | >WENV171003452 |
Genome ID | NNBU01000031 |
Search identical group | |
Phylum/Class | [NNBU] plant metagenome; symbiotic tissue sample KVJ2 |
Species | |
Start position on genome | 31442 |
End posion on genome | 31365 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
accaaaattt |
tRNA gene sequence |
GCTCCTGTAGCCCAATTGGAAGAGGTGACAGACTTAAAATCTGTTTGGTTGTGGGTTCGA |
Downstream region at tRNA end position |
acgggatgta |
Secondary structure (Cloverleaf model) | >WENV171003452 Leu TAA t ACTA acgggatgta G + T C - G T - A C - G C - G T - A G - C T C T C A C C C A T A A A | | | | | G T C C C G G T G G G C G | | + T T G A G G T A A G G TTGGTT A - T C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |