| Sequence ID | >WENV171003634 |
| Genome ID | NNBU01001176 |
| Phylum/Class | [NNBU] plant metagenome; symbiotic tissue sample KVJ2 |
| Species | |
| Start position on genome | 6645 |
| End posion on genome | 6729 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
tcagaaccct |
| tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACGCAGGGGACTCAAAATCCCCCACCGAAAGGTGTGCC |
| Downstream region at tRNA end position |
cacactttgg |
| Secondary structure (Cloverleaf model) | >WENV171003634 Leu CAA
t ACCA cacactttgg
G - C
C - G
C - G
C - G
G - C
G - C
G - C T T
T C G G C C A
T A A G | | | | | G
T A G T G G C C G G C
G | + | T T
G A C G C
T A G A CACCGAAAGGTGT
G - C
G - C
G - C
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |