Sequence ID | >WENV171003761 |
Genome ID | NNBV01000658 |
Search identical group | |
Phylum/Class | [NNBV] plant metagenome; symbiotic tissue sample KVS11 |
Species | |
Start position on genome | 2510 |
End posion on genome | 2435 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcggagtgt |
tRNA gene sequence |
GGGCCGGTAGCTCAATGGTTAGAGCTCGCTGCTCATAACAGCGCCGGTGCCGGTTCGAGT |
Downstream region at tRNA end position |
ttccctttgt |
Secondary structure (Cloverleaf model) | >WENV171003761 Met CAT t ACCA ttccctttgt G - C G - C G - C C - G C - G G - C G - C T G T C G G C C A T A A A | | | | | G G C T C G G C C G G C G | | | | T T T G A G C T A T CCGGT C - G G - C C - G T - A G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |