| Sequence ID | >WENV171003867 |
| Genome ID | NNBV01002980 |
| Phylum/Class | [NNBV] plant metagenome; symbiotic tissue sample KVS11 |
| Species | |
| Start position on genome | 406 |
| End posion on genome | 318 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
atcatataat |
| tRNA gene sequence |
GCTCGGATGGTGAAATTGGTAGACACGCTGGACTTAAAATCCAGTGAACAGCAATGTTCG |
| Downstream region at tRNA end position |
aagcctcttc |
| Secondary structure (Cloverleaf model) | >WENV171003867 Leu TAA
t ACTA aagcctcttc
G + T
C - G
T - A
C - G
G + T
G - C
A - T T G
T C G C C C A
T A A G | | | | | A
T A G T G G C G G G C
G | | | T T
G A C A C
T A G G TGAACAGCAATGTTCGT
C - G
T - A
G - C
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |