| Sequence ID | >CL170700008 |
| Genome ID | CP002988 |
| Phylum/Class | Euryarchaeota |
| Species | halophilic archaeon DL31 [CP002988] |
| Start position on genome | 808575 |
| End posion on genome | 808399 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
tcgagcgcga |
| tRNA gene sequence |
GGGGACGTGGCCAAGCCCGGCATGGCGACTGACTCCAGATCAGTCGATCGGGGGTTCAAA |
| Downstream region at tRNA end position |
tgcttccgcg |
| Secondary structure (Cloverleaf model) | >CL170700008 Trp CCA
a ACtt tgcttccgcg
G - C
G - C
G - C
G - C
A - T
C - G
G - C T A
T C T C C C A
C G A G | + | | | A
C A C C G G G G G G C
C | | | | T T
G T G G C
G C A G CGATC
A - T
C - G
T - A
G - C
A - T
C A
T G *
C C A
intron: position=38, length=102 (in A-loop)
AGGCTACGCGCCCGGTGACGAACTCCAGACTGATATACCGAGTCGGCGACTGATCATCGCTGGCGATGAC
GACCCTCTGGAGGACCGAGGCGCACCGGAGAT
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |