Sequence ID | >VRL185000028 |
Genome ID | FN600414 |
Search identical group | |
Phylum/Class | Phycodnaviridae |
Species | Ostreococcus tauri virus 2 (FN600414) |
Start position on genome | 136348 |
End posion on genome | 136422 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gctggaccaT |
tRNA gene sequence |
TTCCTTGTAACTCAATCGGAAGAGTGTACGACTGTTAATCGTAAAGTAGCGAGATCGAAA |
Downstream region at tRNA end position |
ttgcatctat |
Secondary structure (Cloverleaf model) | >VRL185000028 Asn GTT T GTtt ttgcatctat T - A T - A C - G C - G T - A T - A G - C A A T C G C T C A T A A A | | | | | G C C T C A G C G A G C G | | | | A T G G A G T A A G AAGTA T - A A - T C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |