Sequence ID | >VRL181000028 |
Genome ID | HM004429 |
Search identical group | |
Phylum/Class | Phycodnaviridae |
Species | Micromonas sp. RCC1109 virus MpV1 (HM004429) |
Start position on genome | 138325 |
End posion on genome | 138398 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gggagcttaa |
tRNA gene sequence |
CCTCTCTTAGCTCAGTTGGGAGAGCAGTGGACTGTAGTTCCAAGGGTCAGGTGTTCGATT |
Downstream region at tRNA end position |
tttcttccat |
Secondary structure (Cloverleaf model) | >VRL181000028 Tyr GTA a ACtt tttcttccat C - G C - G T - A C - G T - A C - G T - A T T T T C C A C A T G A A | | | | | G T C T C G A G G T G C G | | | | T T G G A G C G A A GGGTC G A T - A G - C G - C A - T C T T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |