Sequence ID | >VRL181000248 |
Genome ID | JX997170 |
Search identical group | |
Phylum/Class | Phycodnaviridae |
Species | Paramecium bursaria Chlorella virus IL-5-2s1 (JX997170) |
Start position on genome | 176047 |
End posion on genome | 176129 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctaaacgtga |
tRNA gene sequence |
GATAGTGTATGCAAGTGGTCAAAGCACCTCGACTTAAGATCGAGTCCCTTACGGGTTCGC |
Downstream region at tRNA end position |
ctggcgagca |
Secondary structure (Cloverleaf model) | >VRL181000248 Leu TAA a Attg ctggcgagca G - C A - T T - A A - T G - C T + G G - C C C T T G C C C A T G A A + | | | | G G A C G T G C G G G C G | | | T T T A G C A C A A C TCCCTTACGGGTTC C - G T - A C - G G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |