Sequence ID | >VRL181000467 |
Genome ID | KM982403 |
Search identical group | |
Phylum/Class | Mimiviridae |
Species | Acanthamoeba polyphaga mimivirus Amazonia (KM982403) |
Start position on genome | 1111310 |
End posion on genome | 1111392 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attaaaataa |
tRNA gene sequence |
GCAAAGGTGGCGGAGTGGTCTAACGCGGTAGACTCAAGATCTACTATCTTTTGATGTCGT |
Downstream region at tRNA end position |
gttctattca |
Secondary structure (Cloverleaf model) | >VRL181000467 Leu CAA a Attc gttctattca G - C C - G A - T A - T A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C C T A G TATCTTTTGATGTC G - C T - A A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |