| Sequence ID | >VRL181000483 |
| Genome ID | KR815459 |
| Phylum/Class | Baculoviridae |
| Species | Anticarsia gemmatalis multiple nucleopolyhedrovirus (KR815459) |
| Start position on genome | 27555 |
| End posion on genome | 27472 |
| Amino Acid | Thr |
| Anticodon | AGT |
| Upstream region at tRNA start position |
ttaacatcga |
| tRNA gene sequence |
GTCTCAGTAGCTTAATGGTTAGAGCGTGGCGCTAGTTATGTAAACATGATGACAAGGTTG |
| Downstream region at tRNA end position |
aattttttgc |
| Secondary structure (Cloverleaf model) | >VRL181000483 Thr AGT
a Aaac aattttttgc
G + T
T - A
C - G
T - A
C - G
A - T
G - C C G
T C G C T C A
T A A A | | | | | A
G T T C G G C G A G C
G + | | | T T
T G A G C
T A G ACATGATGACAAGGTT
T - A
G A
G + T
C - G
G + T
C A
T T
A G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |