Sequence ID | >VRL181000521 |
Genome ID | KT820662 |
Search identical group | |
Phylum/Class | Phycodnaviridae |
Species | Chrysochromulina ericina virus (KT820662) |
Start position on genome | 424072 |
End posion on genome | 424144 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tatactctaa |
tRNA gene sequence |
GTTCCCTTAGCTCAGTTGGTAGAGCGCACGACTTTTAATCGTGTGGCCAGCGGTTCGAGC |
Downstream region at tRNA end position |
tattatagtc |
Secondary structure (Cloverleaf model) | >VRL181000521 Lys TTT a Attt tattatagtc G + T T - A T - A C - G C - G C - G T - A C G T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G TGGCC C - G A - T C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |