| Sequence ID | >VRL181000558 |
| Genome ID | KX853510 |
| Phylum/Class | unclassifiedviruses |
| Species | Virus Rctr197k (KX853510) |
| Start position on genome | 188674 |
| End posion on genome | 188600 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
gggacgtttt |
| tRNA gene sequence |
GGTGACGTGGCGCGAAAGGCTTAGGCGCCGCTCTGCAAAAGCGGTTCATGCCGGTTCGAG |
| Downstream region at tRNA end position |
cttgaagatg |
| Secondary structure (Cloverleaf model) | >VRL181000558 Cys GCA
t TCtt cttgaagatg
G - C
G - C
T - A
G - C
A - T
C - G
G - C T G
T C G G C C A
A A G G | | | | | G
A C G C G G C C G G C
G | | T T
G A G G C
C T T G TTCAT
C - G
C - G
G - C
C - G
T - A
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |