Sequence ID | >VRL181000691 |
Genome ID | MF405918 |
Search identical group | |
Phylum/Class | Varidnaviria |
Species | Tupanvirus deep ocean (MF405918) |
Start position on genome | 286715 |
End posion on genome | 286642 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ctggcgctaC |
tRNA gene sequence |
ACTCCCGTAGCTTAATGGTAAAGCATACGTTTCCTAAACGTCAGATTGCGGGTTCGAGTC |
Downstream region at tRNA end position |
ccgtttatcg |
Secondary structure (Cloverleaf model) | >VRL181000691 Arg CCT C GAta ccgtttatcg A - T C - G T + G C - G C - G C - G G - C T G T T G C C C A A A A + | | | | G T T T C G G C G G G C G | | | | T T G A A G C T A A AGATT T C A - T C - G G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |