Sequence ID | >VRL181000696 |
Genome ID | MF405918 |
Search identical group | |
Phylum/Class | Varidnaviria |
Species | Tupanvirus deep ocean (MF405918) |
Start position on genome | 277603 |
End posion on genome | 277533 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tgtaataaca |
tRNA gene sequence |
GGGCCATTAGTTTAATGGTAGAACGACGTGTTCGCAACACGGAGGAGAGAGTTCGATTCT |
Downstream region at tRNA end position |
tgatgatgat |
Secondary structure (Cloverleaf model) | >VRL181000696 Ala CGC a Atga tgatgatgat G - C G - C G + T C - G C - G A - T T - A T T T C T C T C A A A A | | | | | G T T T T G G A G A G C G + | | | T T G G A A C T A G AGGA A G C - G G - C T - A G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |