Sequence ID | >PL191000212 |
Genome ID | CP013103 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Paraburkholderia caribensis MWAP64 plasmid: (CP013103) |
Start position on genome | 658457 |
End posion on genome | 658533 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gctcttcgct |
tRNA gene sequence |
AGGCTCGTAGCTCAGCTGGTTAGAGCACCACCTTGACATGGTGGGGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
acgaatatac |
Secondary structure (Cloverleaf model) | >PL191000212 Val GAC t ACCA acgaatatac A - T G - C G - C C - G T - A C - G G - C T G T T A A C C A C G A A + | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |