Sequence ID | >PL191000477 |
Genome ID | CP025870 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli 503829 plasmid:p503829_100 (CP025870) |
Start position on genome | 23587 |
End posion on genome | 23513 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cgcgaaatat |
tRNA gene sequence |
GATGGTGTAGCTCAGTGGTAGAGCGGTTGACTGTTAATCAACTGGTCGGTGGTTCGAGTC |
Downstream region at tRNA end position |
acacagcgct |
Secondary structure (Cloverleaf model) | >PL191000477 Asn GTT t GCCA acacagcgct G - C A - T T - A G - C G - C T - A G - C T G T C C A C C A G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T A G TGGTC G - C T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |