Sequence ID | >PL191000664 |
Genome ID | CP027590 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli 2014C-3011 plasmid:unnamed2 (CP027590) |
Start position on genome | 40704 |
End posion on genome | 40779 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccaccacatt |
tRNA gene sequence |
GCCGATTTAGCTCAGTTGGTAGAGCAGTCGCTTTGTAAGCGAATGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
acataacagg |
Secondary structure (Cloverleaf model) | >PL191000664 Thr TGT t ACCA acataacagg G - C C - G C - G G - C A - T T - A T - A C T T T T G C C A T G A A | + | | | G T C T C G A G C G G C G | | | | T T G G A G C T A A TGGTC G A T - A C - G G - C C - G T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |