| Sequence ID | >PL191000723 |
| Genome ID | CP029356 |
| Phylum/Class | Alphaproteobacteria |
| Species | Azospirillum sp. CFH 70021 plasmid:unnamed1 (CP029356) |
| Start position on genome | 649442 |
| End posion on genome | 649518 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
gcgtcgtgaa |
| tRNA gene sequence |
GGGCTAGTAGCTCAGTTGGTTAGAGCGCGCGCTTGATAAGCGTGAGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
tccctcaggc |
| Secondary structure (Cloverleaf model) | >PL191000723 Ile GAT
a ACCA tccctcaggc
G - C
G - C
G - C
C - G
T + G
A - T
G - C T A
T C C T C C A
T G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
G + T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |