Sequence ID | >PL191000820 |
Genome ID | CP030784 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia albertii 2012EL-1823B plasmid:unnamed1 (CP030784) |
Start position on genome | 13945 |
End posion on genome | 14020 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
catcgccaac |
tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGTAGAGCGCCTGCCTTGTAAGCAGGATGTCAGCGGTTCGAGT |
Downstream region at tRNA end position |
gcacaacagg |
Secondary structure (Cloverleaf model) | >PL191000820 Thr TGT c ACCA gcacaacagg G - C C - G C - G G - C G - C T - A T - A T G T T T G C C A T G A A | + | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |