Sequence ID | >PL191000846 |
Genome ID | CP031166 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Euzebya sp. DY32-46 plasmid:pEDY32-46I (CP031166) |
Start position on genome | 346135 |
End posion on genome | 346209 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
acgcccacac |
tRNA gene sequence |
GGGGCTCTAGCTCATCGTGGCAGAGCACGTCCCTGGCAGGGACGAGGTGCGGGGTTCAAG |
Downstream region at tRNA end position |
gccgcccatc |
Secondary structure (Cloverleaf model) | >PL191000846 Ala GGC c ACtg gccgcccatc G - C G - C G + T G - C C - G T - A C - G C G T G C C C C A C T A A | | | | | A G C T C G C G G G G C T | | | | T T G G A G C G C A A AGGTG C - G G - C T - A C - G C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |