Sequence ID | >PL191000876 |
Genome ID | CP031304 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloterrigena jeotgali A29 plasmid:unnamed6 (CP031304) |
Start position on genome | 298556 |
End posion on genome | 298630 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ggcctcgtgc |
tRNA gene sequence |
GGGTTGGTGATCTAGTCCGGTTATGATACCTCCTTCACACGGAGGAAGCCGGCGGTTCAA |
Downstream region at tRNA end position |
cgctccttcc |
Secondary structure (Cloverleaf model) | >PL191000876 Val CAC c Atta cgctccttcc G - C G - C G - C T - A T - A G - C G - C T A T C C G C C A C T G A G | | | | | A C T C T A G G C G G C G | | | T T G T G A T T T A A AAGCC C - G C - G T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |