Sequence ID | >PL191001300 |
Genome ID | CP035412 |
Search identical group | |
Phylum/Class | Firmicutes |
Species | Bacillus subtilis SRCM103622 plasmid:unnamed1 (CP035412) |
Start position on genome | 63433 |
End posion on genome | 63509 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttttttctat |
tRNA gene sequence |
GTGCTCGTAGCTCAGGTGGTTAGAGCATCGGTCTGTTAAACCGAGTGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
tgagggttta |
Secondary structure (Cloverleaf model) | >PL191001300 Asn GTT t GCCA tgagggttta G - C T - A G + T C - G T - A C - G G - C T A T C A T C C A G G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T T A A GTGTC T - A C - G G - C G - C T - A C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |