Sequence ID | >PL191001627 |
Genome ID | LR134450 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Tsukamurella tyrosinosolvens NCTC13231 plasmid:8 (LR134450) |
Start position on genome | 284944 |
End posion on genome | 284870 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ggtcacctaa |
tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCATCCGCTTTGGGAGCGGAGGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
agatcccgcg |
Secondary structure (Cloverleaf model) | >PL191001627 Pro TGG a ACgc agatcccgcg C - G G - C G - C G - C G - C T - A G - C T A T T G T G C A C G A G + | | | | G T C G C G G C A C G C T | | | | T T G G C G C G T A A GGGTC T - A C - G C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |