Sequence ID | >PL191001666 |
Genome ID | LR134464 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Tsukamurella tyrosinosolvens NCTC13231 plasmid:22 (LR134464) |
Start position on genome | 134871 |
End posion on genome | 134945 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttaccggcac |
tRNA gene sequence |
GGCCAGGTAGCTCAGTTGGTACGAGCGACCGCCTGAAAAGCGGTAGGTCGCCGGTTCGAT |
Downstream region at tRNA end position |
gaaaaccccc |
Secondary structure (Cloverleaf model) | >PL191001666 Phe GAA c ACaa gaaaaccccc G - C G - C C - G C - G A - T G - C G + T C T T C G G C C A T G A A | | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A C G AGGTC A - T C - G C - G G - C C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |