Sequence ID | >PL193000088 |
Genome ID | CP030938 |
Search identical group | |
Phylum/Class | Firmicutes |
Species | Bacillus sp. DM2 plasmid:unnamed (CP030938) |
Start position on genome | 39611 |
End posion on genome | 39684 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
agtacgccat |
tRNA gene sequence |
GAGGGTTTAGTTTAATGGTAAAACGTCAGTCTCCAAAACTGAAAATGTTGGTTCGATTCC |
Downstream region at tRNA end position |
ataaatataa |
Secondary structure (Cloverleaf model) | >PL193000088 Trp CCA t GCCA ataaatataa G + T A - T G - C G - C G - C T - A T - A T T T C T T C C A A A A | | | G T T T T G G T T G G C G | | | | T T G A A A C T A G AAAT T - A C - G A - T G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |