Sequence ID | >PHG183000233 |
Genome ID | KT345706 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Vibrio phage vB_VorS-PVo5 (KT345706) |
Start position on genome | 319 |
End posion on genome | 244 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cattattttt |
tRNA gene sequence |
ACTCCCTTAGCTCAGTGTGTAGAGCACCTCCCTTACAAGGAGGGGGTCGTTGGTTCGAGT |
Downstream region at tRNA end position |
tttcatttgc |
Secondary structure (Cloverleaf model) | >PHG183000233 Val TAC t ACCA tttcatttgc A - T C - G T - A C - G C - G C - G T - A T G T C A A C C A T G A A | | | | | G G C T C G G T T G G C T | | | | T T G G A G C T A A GGGTC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |