Sequence ID | >PHG183000969 |
Genome ID | MF431732 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Bacteriophage T5-like pork29 (MF431732) |
Start position on genome | 35859 |
End posion on genome | 35772 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttctaaatat |
tRNA gene sequence |
GGGCGTTTATTCCGTAAGTGGTAGCGGAGGGGATTGTAAATCCCTGGTCATTGCGACTCG |
Downstream region at tRNA end position |
aatttaatac |
Secondary structure (Cloverleaf model) | >PHG183000969 Tyr GTA t ACCA aatttaatac G - C G - C G - C C - G G - C T - A T - A T C T T T A C C A A A T G A | + | | | G G C C T T A G T G G C T | + + T T G G C G G G T A A GGTCATTGCGACTCG G + T G - C G - C G - C A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |