Sequence ID | >PHG181000493 |
Genome ID | KJ019114 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage ACG-2014a (KJ019114) |
Start position on genome | 13064 |
End posion on genome | 13135 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctcgtatcta |
tRNA gene sequence |
GGGCGAATAACTCAGCGGTAGAGTGCCTCCTTTACACGGAGATTGTCGGGGGTTCGATCC |
Downstream region at tRNA end position |
tcaatttatt |
Secondary structure (Cloverleaf model) | >PHG181000493 Val TAC a Atgt tcaatttatt G - C G - C G - C C - G G - C A - T A - T C T T C T C C C A G A A | + | | | G C C T C A G G G G G C G | | | | T T G G A G T T A G TTGTC C A C - G T - A C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |