Sequence ID | >PHG181000537 |
Genome ID | KJ019127 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage ACG-2014d (KJ019127) |
Start position on genome | 13624 |
End posion on genome | 13697 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttaacctctT |
tRNA gene sequence |
GGGTGATTAACTCAGTGGTAGAGTGACTGCTTTACACGCAGTAGGTCACTGGTTCAAATC |
Downstream region at tRNA end position |
gtaatgtaat |
Secondary structure (Cloverleaf model) | >PHG181000537 Val TAC T ATtc gtaatgtaat G - C G - C G - C T - A G + T A - T T - A T A T T G A C C A G A A | | | | | A T C T C A A C T G G C G | | | | T T G G A G T T A G AGGTC A - T C - G T - A G - C C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |