Sequence ID | >PHG181000681 |
Genome ID | KJ081346 |
Search identical group | |
Phylum/Class | Herelleviridae |
Species | Bacillus phage BCP8-2 (KJ081346) |
Start position on genome | 33876 |
End posion on genome | 33800 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaggtatcct |
tRNA gene sequence |
ACTAGTGTAGCTCAGTCAGGTAGAGCAGTGTCTTGATAAGGCATTGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
tttgttatgt |
Secondary structure (Cloverleaf model) | >PHG181000681 Ile GAT t ACCA tttgttatgt A - T C - G T - A A - T G - C T - A G - C T A T T G T C C A T G A A | | | | | A C C T C G A C A G G C A | | | | T T G G A G C G T A A TGGTC G + T T - A G - C T + G C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |