Sequence ID | >PHG181000682 |
Genome ID | KJ081346 |
Search identical group | |
Phylum/Class | Herelleviridae |
Species | Bacillus phage BCP8-2 (KJ081346) |
Start position on genome | 33791 |
End posion on genome | 33706 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
catttgttat |
tRNA gene sequence |
GTCAGAGTGTTGGAATTGGTAGACTTGGCAGATTTAGAATCTGCTGTCCTAGTGGCGTGA |
Downstream region at tRNA end position |
acatggggga |
Secondary structure (Cloverleaf model) | >PHG181000682 Leu TAG t ACCA acatggggga G - C T - A C - G A - T G - C A - T G - C T G T C T C C C A T A A G | | | | | A T G G T T G A G G G C G | T T G A C T T T A G G TGTCCTAGTGGCGT G - C C - G A - T G - C A - T T A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |