Sequence ID | >PHG181001830 |
Genome ID | KT919973 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Vibrio phage phi-ST2 (KT919973) |
Start position on genome | 98597 |
End posion on genome | 98521 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtttattcaa |
tRNA gene sequence |
GCCCAACTAGTCCAATTGGCAGAGGCACTAGTTTCAAACACTAGGAGTTCCGAGTTCGAA |
Downstream region at tRNA end position |
aattcactta |
Secondary structure (Cloverleaf model) | >PHG181001830 Leu CAA a ACCA aattcactta G - C C - G C - G C - G A - T A - T C - G T A T G G C T C A T A A A | | | | | G T C C T G C C G A G C G | + | T T G A G G C C A G A GAGTT C - G T - A A - T G - C T - A T C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |