Sequence ID | >PHG181001969 |
Genome ID | KU160663 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Arthrobacter phage Rings (KU160663) |
Start position on genome | 4142 |
End posion on genome | 4214 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aagacggcta |
tRNA gene sequence |
GGGAAGATGGTGTAGTCGGTAACATGGCGGTCTCCAAAACCGTTGTCAGGGGTTCGAGCC |
Downstream region at tRNA end position |
cgtctttgac |
Secondary structure (Cloverleaf model) | >PHG181001969 Trp CCA a GCga cgtctttgac G + T G - C G - C A - T A - T G - C A - T C G T T C T C C A T G A G | | + | | G C T G T G A G G G G C G | | | + T T G A C A T T A G TGTC G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |