Sequence ID | >PHG181002240 |
Genome ID | KU686203 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage S-CAM8 (KU686203) |
Start position on genome | 13494 |
End posion on genome | 13565 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcactagaaa |
tRNA gene sequence |
GCCCGAATAGCTCAGCGGTAGAGCAGCACCTTTACACGGTGAATGTCGGGGGTTCGATCC |
Downstream region at tRNA end position |
tcaatttact |
Secondary structure (Cloverleaf model) | >PHG181002240 Val TAC a Attg tcaatttact G - C C - G C - G C - G G + T A - T A - T C T T C T C C C A G A A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A ATGTC G A C - G A - T C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |