Sequence ID | >PHG181002260 |
Genome ID | KU686205 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage S-CAM9 (KU686205) |
Start position on genome | 144468 |
End posion on genome | 144539 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcagtgtttc |
tRNA gene sequence |
GGGCGATTAACTCAGCGGTAGAGTGGCCTCCTTACAAGTGGTAAGTCACTGGTTCGATTC |
Downstream region at tRNA end position |
tcttaaaatt |
Secondary structure (Cloverleaf model) | >PHG181002260 Val TAC c Atga tcttaaaatt G - C G - C G - C C - G G - C A - T T - A T T T T G A C C A G A A | | | | | G C C T C A A C T G G C G | | | | T T G G A G T T A G AAGTC G + T C - G C - G T T C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |