Sequence ID | >PHG181002498 |
Genome ID | KX017521 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Salmonella phage 118970_sal2 (KX017521) |
Start position on genome | 35282 |
End posion on genome | 35200 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ccaaatttta |
tRNA gene sequence |
GGGTCGTTAGCCAAGCGGTTTGGCGGTGGACTGTTAATCCATGTTGAAAGACAACGTAGG |
Downstream region at tRNA end position |
atttcattaa |
Secondary structure (Cloverleaf model) | >PHG181002498 Asn GTT a GCCA atttcattaa G - C G - C G - C T + G C - G G - C T - A T A T C A T C C A G A A | | | | | G C A C C G G T A G G C G | | | | T T G T G G C T T G GTTGAAAGACAAC G + T T - A G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |