Sequence ID | >PHG181002629 |
Genome ID | KX349227 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage S-RIM2 (KX349227) |
Start position on genome | 13794 |
End posion on genome | 13865 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcactaggaa |
tRNA gene sequence |
GCCCGAATAGCTCAGCGGTAGAGCACCTCGTTTACACCGAGATTGTCGGCGGTTCGATCC |
Downstream region at tRNA end position |
gtcacttata |
Secondary structure (Cloverleaf model) | >PHG181002629 Val TAC a Atta gtcacttata G - C C - G C - G C - G G - C A - T A - T C T T C T G C C A G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A TTGTC C A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |