Sequence ID | >PHG181002988 |
Genome ID | KX349286 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Synechococcus phage S-RIM8 (KX349286) |
Start position on genome | 19089 |
End posion on genome | 19162 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttgggtattt |
tRNA gene sequence |
GCCTCCGTAGCTCAGCTGGATAGAGCAACGGTTTTGTAAACCGTAGGTCGTCGGTTCAAG |
Downstream region at tRNA end position |
gcaatcattt |
Secondary structure (Cloverleaf model) | >PHG181002988 Thr TGT t Ttcc gcaatcattt G - C C - G C - G T + G C T C - G G - C T G T C A G C C A C G A A | | | | | A T C T C G G T C G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |