Sequence ID | >PHG181003216 |
Genome ID | KX377933 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Escherichia phage vB_EcoM_Alf5 (KX377933) |
Start position on genome | 27446 |
End posion on genome | 27523 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgagtaccat |
tRNA gene sequence |
GTTCCAGTATCCCAATTGGCAGAGGATGCAAGCTCAAACCTTGTATTAGTGACGGTTCGA |
Downstream region at tRNA end position |
atttaaagag |
Secondary structure (Cloverleaf model) | >PHG181003216 Leu CAA t ACCA atttaaagag G - C T - A T - A C - G C - G A - T G + T T A T C T G C C A T A A A | | | | | G T C C C T G A C G G C G | | | T T G A G G A C A G T ATTAGT G + T C - G A - T A - T G - C C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |