Sequence ID | >PHG181003798 |
Genome ID | KY114934 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Salmonella phage SP01 (KY114934) |
Start position on genome | 86810 |
End posion on genome | 86888 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggttactaat |
tRNA gene sequence |
AGATCGCTAGCTCAATAGGTTTAGTAGCATCCGACTTTTAATCGGAAGGTTCTGGGTTCG |
Downstream region at tRNA end position |
atttcaagaa |
Secondary structure (Cloverleaf model) | >PHG181003798 Lys TTT t ACCA atttcaagaa A - T G - C A - T T - A C - G G - C C - G T G T G A C C C A A T A A A | | | | | G G C T C G C T G G G C G | | | T T T T A G C T T A G A AGGTT T - A C - G C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |