Sequence ID | >PHG181003967 |
Genome ID | KY385381 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Mycobacterium phage EniyanLRS (KY385381) |
Start position on genome | 59782 |
End posion on genome | 59864 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaaaaacttt |
tRNA gene sequence |
GCGTCAGACGCACATTGGGTAGTGCAGCGGTCTGTAAAACCGTCGCCTTCGGGCATTGGG |
Downstream region at tRNA end position |
taaggggttg |
Secondary structure (Cloverleaf model) | >PHG181003967 Tyr GTA t ACtt taaggggttg G - C C - G G - C T - A C - G A - T G - C T G A C T C C C A T T A C | + | | | A G C A C G G G G G G C G | | | | T T G G T G C T A A CGCCTTCGGGCATT G + T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |