Sequence ID | >PHG181004054 |
Genome ID | KY554777 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Lactococcus phage LW81 (KY554777) |
Start position on genome | 53062 |
End posion on genome | 53134 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tcttttttgg |
tRNA gene sequence |
GGTTTGTTGGTGTAGTGGTTATCACGCTTGCCTGTCACGCAAGAGAACACGGGTTCGAAT |
Downstream region at tRNA end position |
ttaactgagg |
Secondary structure (Cloverleaf model) | >PHG181004054 Asp GTC g Gtaa ttaactgagg G - C G + T T - A T - A T - A G - C T - A T A T T G C C C A T G A G | | | | | G G T G T G A C G G G C G | | | T T T T C A C T A G AGAAC C - G T - A T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |