Sequence ID | >PHG181004096 |
Genome ID | KY555143 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Caulobacter phage Ccr2 (KY555143) |
Start position on genome | 103655 |
End posion on genome | 103733 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctttacagaa |
tRNA gene sequence |
CGCGGGGTAGAGGAGTCCGGTTGTCCTCGTCTGGCTCATAACCAGGAGATCGTGGGTTCA |
Downstream region at tRNA end position |
atgcgaacgc |
Secondary structure (Cloverleaf model) | >PHG181004096 Met CAT a CCCA atgcgaacgc C T G - C C - G G - C G - C G - C G + T T A T C A C C C A C T G A A | | | | | A C G G A G G T G G G C G | | | | T T G C C T C T T G T G AGATC T + G C - G T - A G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |