Sequence ID | >PHG181004126 |
Genome ID | KY555145 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Caulobacter phage Ccr29 (KY555145) |
Start position on genome | 52980 |
End posion on genome | 53053 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tccaattcat |
tRNA gene sequence |
GCGGGTATAGCTCAAAGGGAGAGCTACTGCCTTCCAAGCAGAAGATGCGGGTTCGAGCCC |
Downstream region at tRNA end position |
aatttttctt |
Secondary structure (Cloverleaf model) | >PHG181004126 Gly TCC t TCCA aatttttctt G - C C - G G - C G - C G + T T - A A - T C G T C G C C C A A A A | | | | | G A C T C G G C G G G C G | | | | T T G G A G C G A T AGAT A A C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |