Sequence ID | >PHG181004938 |
Genome ID | MF140413 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Mycobacterium phage Kingsolomon (MF140413) |
Start position on genome | 63813 |
End posion on genome | 63887 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tccgggttgc |
tRNA gene sequence |
GGTTCCGTAGGCAAACTGGCAAAGCCGTCTGACTTAGAATCAGGTGTTTGGGAGTTCGAC |
Downstream region at tRNA end position |
taagtagctt |
Secondary structure (Cloverleaf model) | >PHG181004938 Leu TAG c ACgc taagtagctt G + T G - C T - A T - A C - G C - G G - C T C T C C C T C A C A A A | | | | | G T A C G G G G G A G C G | | | T T G A G C C C A A G TGTTT T + G C - G T - A G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |