Sequence ID | >PHG181004983 |
Genome ID | MF155946 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage Mildred21 (MF155946) |
Start position on genome | 85156 |
End posion on genome | 85231 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccgtagactt |
tRNA gene sequence |
GCGCCGTTGACGGGAACTGGCATACCTAGTTGACTTAGAATCAACTGCTTGGGAGTTCGA |
Downstream region at tRNA end position |
cataattgta |
Secondary structure (Cloverleaf model) | >PHG181004983 Leu TAG t ACtc cataattgta G + T C - G G - C C - G C - G G - C T - A T C T C C C T C A C A A G G | | | | | G T G G C A G G G A G C G | | T T G A C C T C A T A TGCTT G - C T - A T - A G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |